Sequence ID | >WENV170652403 |
Genome ID | JRYH01002150 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12763 |
End posion on genome | 12681 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccgcggcgac |
tRNA gene sequence |
GGGCGTGTACCCAAGTGGCCAAAGGGGGCAGACTGTAAATCTGCTGGCGTACGCCTTCGC |
Downstream region at tRNA end position |
gccccgtccc |
Secondary structure (Cloverleaf model) | >WENV170652403 Tyr GTA c Attc gccccgtccc G - C G - C G - C C - G G - C T + G G - C T A T C G A C C A T G A A | | | | | G G A C C C G C T G G C G | | | T T C A G G G C A A G TGGCGTACGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |