Sequence ID | >WENV170652404 |
Genome ID | JRYH01002202 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 534 |
End posion on genome | 608 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
taccctttgc |
tRNA gene sequence |
TGGGGCATAGTATAACGGTAGTACTATGGACTCTGGATCCATCAGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
Agccatttcc |
Secondary structure (Cloverleaf model) | >WENV170652404 Gln CTG c CCCC Agccatttcc T + G G - C G - C G - C G - C C - G A - T T A T G A T C C A A A A | | | | | G C T A T G C T A G G C G + | | | T T G G T A C T A T CAGT A - T T - A G - C G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |