Sequence ID | >WENV170652409 |
Genome ID | JRYH01002278 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1192 |
End posion on genome | 1116 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acgcatcctt |
tRNA gene sequence |
GGCGGGATAGCTCAGGTGGTTAGAGCGACGGTCTCATAATCCGTAGGTCGGCGGTTCAAG |
Downstream region at tRNA end position |
aaatttccct |
Secondary structure (Cloverleaf model) | >WENV170652409 Met CAT t ACCA aaatttccct G + T G - C C - G G - C G - C G - C A - T T G T C C G C C A G G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC A - T C - G G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |