Sequence ID | >WENV170652416 |
Genome ID | JRYH01002583 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8110 |
End posion on genome | 8186 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccgtttctg |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTAGCGCAACTGCTTTGGGAGCAGTAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ggcgccgcct |
Secondary structure (Cloverleaf model) | >WENV170652416 Pro TGG g ACCA ggcgccgcct C - G G - C G - C G - C G - C T - A G - C T A T C T C C C A T G A A | + | | | G C C G C G G G G G G C T | | | | T T G G C G C G T A A AGGTC A - T C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |