Sequence ID | >WENV170652419 |
Genome ID | JRYH01002583 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8619 |
End posion on genome | 8694 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gtctctacat |
tRNA gene sequence |
GGGCCATTAGCTCAATCGGTAGAGCAGTTGACTCTTAATCAATTGGTTCGGGGTTCGAGT |
Downstream region at tRNA end position |
atgatcgccg |
Secondary structure (Cloverleaf model) | >WENV170652419 Lys CTT t ACCA atgatcgccg G - C G - C G - C C - G C - G A - T T - A T G T G T C C C A T A A A | + | | | G C C T C G C G G G G C G | | | | T T G G A G C T A A TGGTT G + T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |