Sequence ID | >WENV170652420 |
Genome ID | JRYH01002583 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 15335 |
End posion on genome | 15410 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtctttgccg |
tRNA gene sequence |
GGGTGCTTAGCTCAGCCGGTAGAGCATCGCCCTTACAAGGCGAGGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
ggatcagagg |
Secondary structure (Cloverleaf model) | >WENV170652420 Val TAC g ACCA ggatcagagg G - C G - C G - C T - A G - C C - G T - A C T T C T G C C A C G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |