Sequence ID | >WENV170652425 |
Genome ID | JRYH01002731 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 697 |
End posion on genome | 624 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tttcgaaatc |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTTGGGAGAGCGCCTGCCTTGCAAGCAGGAGGTCGGCGGTTCGAA |
Downstream region at tRNA end position |
gactgcaaac |
Secondary structure (Cloverleaf model) | >WENV170652425 Ala TGC c Ataa gactgcaaac G - C G - C G + T G - C G - C T - A G - C C A T T C G C C A C G A A + | | | | G T C T C G G G C G G C T | | | | T T G G A G C G G A G AGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |