Sequence ID | >WENV170652428 |
Genome ID | JRYH01003041 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 316 |
End posion on genome | 392 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccggttcact |
tRNA gene sequence |
GGCGCATTAGCTCAGTTGGTTAGAGCGACGGAATCATAATCCGCAGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
cccccattcc |
Secondary structure (Cloverleaf model) | >WENV170652428 Met CAT t ACCA cccccattcc G - C G - C C - G G - C C - G A - T T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A G AGGTC A C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |