Sequence ID | >WENV170652429 |
Genome ID | JRYH01003043 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 859 |
End posion on genome | 783 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tctgagcttc |
tRNA gene sequence |
GGGCTAGTAGCTCAGCTGGTTAGAGCGCGCGCTTGATAAGCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
gtcagatggc |
Secondary structure (Cloverleaf model) | >WENV170652429 Ile GAT c ACCA gtcagatggc G - C G - C G - C C - G T + G A - T G - C T G T C C T C C A C G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G G + T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |