Sequence ID | >WENV170652433 |
Genome ID | JRYH01003160 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3910 |
End posion on genome | 3985 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaagcaaaaa |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGGTGTTCAATT |
Downstream region at tRNA end position |
ttctccttcg |
Secondary structure (Cloverleaf model) | >WENV170652433 Phe GAA a ACCA ttctccttcg G - C C - G C - G C - G A - T G - C G - C T T T C C C A C A T G A A | | | | | A T C T C G G G G T G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |