Sequence ID | >WENV170652435 |
Genome ID | JRYH01003210 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8451 |
End posion on genome | 8528 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gggccgaagt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTTAGCGCACCAGTCTGGGGGACTGGGGGTCGGAGGTTCAA |
Downstream region at tRNA end position |
attttttcaa |
Secondary structure (Cloverleaf model) | >WENV170652435 Pro GGG t ACCA attttttcaa C - G G - C G - C A - T G - C C - G G - C T A T T C T C C A C C G A A + | | | | A T C G C G G G A G G C G | | | | T T G G C G C T T A A GGGTC C - G C - G A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |