Sequence ID | >WENV170652442 |
Genome ID | JRYH01003506 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5820 |
End posion on genome | 5731 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gcgtgcgtcc |
tRNA gene sequence |
GGAAAGGTGGCAGAGTGGTCGAATGCGCCGGACTCGAAATCCGGTTTGCGGGCAACCGCA |
Downstream region at tRNA end position |
ggatgatcgg |
Secondary structure (Cloverleaf model) | >WENV170652442 Ser CGA c GCCA ggatgatcgg G - C G - C A - T A - T A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C C G A G TTTGCGGGCAACCGCAAC C - G C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |