Sequence ID | >WENV170652447 |
Genome ID | JRYH01003556 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3192 |
End posion on genome | 3116 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
catcaggtaa |
tRNA gene sequence |
GCCGCCTTAGCTCAGATGGTTAGAGCGCTAGATTGTGGATCTAGAGGTCCCCCGTTCGAT |
Downstream region at tRNA end position |
gatgaaatcc |
Secondary structure (Cloverleaf model) | >WENV170652447 His GTG a ACCA gatgaaatcc G + T C - G C - G G - C C - G C - G T - A C T T G G G G C A A G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |