Sequence ID | >WENV170652448 |
Genome ID | JRYH01003597 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8965 |
End posion on genome | 8892 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcccacctca |
tRNA gene sequence |
GGCGAGGTAGCTCAGCCGGTTAGAGCGGAGGATTCATAACCCTCAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
cccgcccgac |
Secondary structure (Cloverleaf model) | >WENV170652448 Met CAT a Attc cccgcccgac G - C G - C C - G G - C A - T G - C G - C T G T C G C T C A C G A A | | | | | G C C T C G G C G A G C G | | | | T T G G A G C T T A G AGGTC G - C A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |