Sequence ID | >WENV170652449 |
Genome ID | JRYH01003688 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4698 |
End posion on genome | 4623 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aagcagcaaa |
tRNA gene sequence |
GGGTGCTTAGCTCAGTTGGTAGAGCGGCGCCCTTACAAGGCGTAGGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
gcgcagcgcc |
Secondary structure (Cloverleaf model) | >WENV170652449 Val TAC a ACCA gcgcagcgcc G - C G - C G - C T - A G - C C - G T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G AGGTC G + T C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |