Sequence ID | >WENV170652451 |
Genome ID | JRYH01003700 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 469 |
End posion on genome | 393 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tcggatgaga |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCACCGTCTTGATAAGGCGGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
atcaattggt |
Secondary structure (Cloverleaf model) | >WENV170652451 Ile GAT a ACCA atcaattggt G - C G - C G - C T - A C - G T - A G - C C A T C A A C C A C G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C T + G C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |