Sequence ID | >WENV170652452 |
Genome ID | JRYH01003700 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 367 |
End posion on genome | 292 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gaagcagtat |
tRNA gene sequence |
GGGGCTGTAGCTCAGCTGGGAGAGCGGCGGCTTTGCAAGCCGTAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
gtactgtcca |
Secondary structure (Cloverleaf model) | >WENV170652452 Ala TGC t ACCA gtactgtcca G - C G - C G + T G - C C - G T - A G - C C T T C A G C C A C G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC G + T C - G G - C G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |