Sequence ID | >WENV170652461 |
Genome ID | JRYH01003724 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 15571 |
End posion on genome | 15494 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
caccaaataa |
tRNA gene sequence |
GCTAGCTAGGCCGATCGGGTGATATGGCAGTGGTTTGTGGCACCACTTAGGTTAGTTCGA |
Downstream region at tRNA end position |
gtttgaaaga |
Secondary structure (Cloverleaf model) | >WENV170652461 His GTG a TCCA gtttgaaaga G + T C - G T - A A - T G - C C - G T - A T C A C A A T C A G C T A G | | | | | G G G C C G G T T A G C G + | | | T T T T G G C G A T A A TTAG G - C T - A G - C G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |