Sequence ID | >WENV170652463 |
Genome ID | JRYH01003725 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 24425 |
End posion on genome | 24351 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tagagattaa |
tRNA gene sequence |
TGGTCTATAGCTCAACGGTAGAGCACTGAGCTGTTAACTCATAGGTTCCCTGTTCGAATC |
Downstream region at tRNA end position |
aatttaaaca |
Secondary structure (Cloverleaf model) | >WENV170652463 Asn GTT a GCCA aatttaaaca T - A G - C G - C T - A C - G T - A A - T T A T G G G A C A A A A | | | | | G C C T C G C C C T G C G | | | | T T G G A G C T A A AGGTT C T T - A G - C A - T G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |