Sequence ID | >WENV170652464 |
Genome ID | JRYH01003725 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 23994 |
End posion on genome | 23907 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atataatcta |
tRNA gene sequence |
GGAGAGATGGTCGAGTGGCTTATGACGCTAGTCTTGAAAACTAGAGACCCGCAAGGGTCC |
Downstream region at tRNA end position |
acattgaaag |
Secondary structure (Cloverleaf model) | >WENV170652464 Ser TGA a GCCA acattgaaag G - C G - C A - T G - C A - T G - C A - T T A T C A T C C A T G A G | | + | | G G G C T G G T G G G C G + | | | T T C T G A C T T A G AGACCCGCAAGGGTCC C - G T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |