Sequence ID | >WENV170652465 |
Genome ID | JRYH01003725 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 23128 |
End posion on genome | 23055 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaactactt |
tRNA gene sequence |
GCCTTTATAGTTAAATGGTATAACAGTGGTTTTGTAACCCATTATTCTCTGTTCGATTCG |
Downstream region at tRNA end position |
aaacctgctt |
Secondary structure (Cloverleaf model) | >WENV170652465 Thr TGT t ACCA aaacctgctt G - C C - G C - G T - A T + G T - A A - T T T T G A G G C A A A A | | | + | G T A T T G C T C T G C G | | | | T T G T A A C T A A TATT G + T T - A G - C G - C T C T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |