Sequence ID | >WENV170652466 |
Genome ID | JRYH01003725 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 23051 |
End posion on genome | 22975 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ggcaccaaaa |
tRNA gene sequence |
CCTGCTTTAGCTTAACTGGATAGAGCACTTGCCTTTCAAGCAGGGAAATGTCGGTTCAAA |
Downstream region at tRNA end position |
aatttagggg |
Secondary structure (Cloverleaf model) | >WENV170652466 Glu TTC a ACCA aatttagggg C - G C - G T - A G - C C - G T - A T - A T A T C T G C C A C A A A | | | | A T T T C G G T C G G C G + | | | T T G G A G C A T A A GAAAT C - G T + G T - A G - C C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |