Sequence ID | >WENV170652467 |
Genome ID | JRYH01003725 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 21835 |
End posion on genome | 21758 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttctcatta |
tRNA gene sequence |
CTGGGGGTAGCTCAGCCTGGTTAGAGTACGTGCCTTGGAAGCACGGGGCCGCTGGTTCAA |
Downstream region at tRNA end position |
gttcagtaca |
Secondary structure (Cloverleaf model) | >WENV170652467 Pro TGG a ACCA gttcagtaca C - G T - A G - C G - C G + T G - C G + T T A T C G A C C A C C G A A | | | | | A T C T C G G C T G G C G | | | + T T G G A G T T T A A GGGCC C - G G - C T - A G - C C - G C A T A T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |