Sequence ID | >WENV170652469 |
Genome ID | JRYH01003790 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 39 |
End posion on genome | 114 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgaaggacac |
tRNA gene sequence |
AGGGGCATAGCTCAACTGGCAGAGCGTCGGTCTCCAAAACCGAAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
tcctccgctg |
Secondary structure (Cloverleaf model) | >WENV170652469 Trp CCA c GCCA tcctccgctg A - T G - C G - C G - C G - C C - G A - T T T T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |