Sequence ID | >WENV170652473 |
Genome ID | JRYH01003958 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3250 |
End posion on genome | 3325 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tccgaggttt |
tRNA gene sequence |
GGGGCCGTAGCTCAGATGGGAGAGCGCTGCAATCGCACTGCAGAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
ctccggttnn |
Secondary structure (Cloverleaf model) | >WENV170652473 Ala CGC t ACCA ctccggttnn G - C G - C G + T G - C C - G C - G G - C T T T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A G - C C - G A - T A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |