Sequence ID | >WENV170652474 |
Genome ID | JRYH01004004 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2209 |
End posion on genome | 2286 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aacactcgac |
tRNA gene sequence |
GCGCTTCTAGCTCAACTGGATCAGAGCGACTCCGTCCTAAGGAGTGGGTTCCGGGTTCGA |
Downstream region at tRNA end position |
ccttcgacac |
Secondary structure (Cloverleaf model) | >WENV170652474 Arg CCT c GCCA ccttcgacac G - C C - G G - C C - G T - A T - A C - G T A T G G T C C A T C A A A | | + | | G G C T C G C C G G G C G | | | | T T A G A G C T C A G GGGTT A - T C - G T - A C - G C - G G A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |