Sequence ID | >WENV170652476 |
Genome ID | JRYH01004121 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 10765 |
End posion on genome | 10682 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cggggtccgt |
tRNA gene sequence |
GCGGGTGTGGCGAAATGGTAGACGCGAGGGTCTCAAACACCCTTTCCGCAAGGAGTGTCG |
Downstream region at tRNA end position |
tgaatttctc |
Secondary structure (Cloverleaf model) | >WENV170652476 Leu CAA t ACCA tgaatttctc G - C C - G G - C G - C G - C T - A G - C T C T C A G C C A T A A G | | | | | G G A G C G G T C G G C G | | | T T T A C G C A G G TTCCGCAAGGAGT A - T G - C G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |