Sequence ID | >WENV170652489 |
Genome ID | JRYH01004814 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7920 |
End posion on genome | 7845 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccggatcttc |
tRNA gene sequence |
GCCGGCTTAGCTCAGTTGGTAGAGCAACCGCCTTGTAAGCGGTAGGTCGTCCGTTCGAGT |
Downstream region at tRNA end position |
gaacctgcgc |
Secondary structure (Cloverleaf model) | >WENV170652489 Thr TGT c ACCA gaacctgcgc G - C C - G C - G G - C G - C C - G T - A T G T C A G G C A T G A A | | | | | G T C T C G G T C C G C G | | | | T T G G A G C T A A AGGTC A - T C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |