Sequence ID | >WENV170652490 |
Genome ID | JRYH01004817 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1478 |
End posion on genome | 1389 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
acccgtccgc |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGACGGGAAACCGTC |
Downstream region at tRNA end position |
ccgcataagc |
Secondary structure (Cloverleaf model) | >WENV170652490 Ser GCT c GCCA ccgcataagc G - C G - C A - T G - C A - T C C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGACGGGAAACCGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |