Sequence ID | >WENV170652492 |
Genome ID | JRYH01004851 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 261 |
End posion on genome | 336 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gccccgccgg |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGCGGTTCGAGT |
Downstream region at tRNA end position |
gccttcgccc |
Secondary structure (Cloverleaf model) | >WENV170652492 Val TAC g ACCA gccttcgccc G - C G - C G - C C - G G - C A - T T - A T G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |