Sequence ID | >WENV170652495 |
Genome ID | JRYH01004961 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 43267 |
End posion on genome | 43340 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ccgcccggcc |
tRNA gene sequence |
CAGGGTGTAGCTCAGCTTGGTAGAGCGCGTGGTTTGGGTCCACGAGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
aggctgcggg |
Secondary structure (Cloverleaf model) | >WENV170652495 Pro TGG c Attg aggctgcggg C - G A - T G - C G - C G - C T - A G - C T A T T G T G C A C G A A + | | | | G T C T C G G C A C G C T | | | | T T G G A G C G T A G AGGTC C - G G - C T - A G - C G - C T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |