Sequence ID | >WENV170652503 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1789 |
End posion on genome | 1862 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cagcattcat |
tRNA gene sequence |
TGCCGGATCGTCTAGCGGCAGGACAGCGGACTCTGACTCCGCTTACGGTGGTTCGAATCC |
Downstream region at tRNA end position |
attatcgata |
Secondary structure (Cloverleaf model) | >WENV170652503 Gln CTG t GCCA attatcgata T - A G - C C - G C - G G - C G - C A - T T A T C T A C C A G A C | + | | | G C T C T G G G T G G C G + | | | T T G G G A C C A A TTAC G - C C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |