Sequence ID | >WENV170652504 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2559 |
End posion on genome | 2632 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acatcaccgt |
tRNA gene sequence |
TCCGGGATCGTCTAATGGCAGGACGCCGGCCTTTGGATCCGGAGACAGACGTTCGACCCG |
Downstream region at tRNA end position |
gcctttttcg |
Secondary structure (Cloverleaf model) | >WENV170652504 Gln TTG t GCCA gcctttttcg T - A C - G C - G G - C G - C G - C A - T C C T T C T G C A A A C | | | | | G T T C T G A G A C G C G + | | | T T G G G A C C A G AGAC C - G C - G G - C G - C C T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |