Sequence ID | >WENV170652505 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2749 |
End posion on genome | 2822 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
caccatgatg |
tRNA gene sequence |
GTGGCTGTAGCTCAATGGCAGAGCGCCGCGCTGTGAACGCGGATACTCGAGTTCAATTCT |
Downstream region at tRNA end position |
gcttctggcc |
Secondary structure (Cloverleaf model) | >WENV170652505 His GTG g CCCA gcttctggcc G - C T - A G - C G + T C - G T - A G - C T T T A G C T C A A A A | | | | | A T C T C G T C G A G C G | | | | T T G G A G C C A G ATAC C - G C - G G - C C - G G - C C A T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |