Sequence ID | >WENV170652506 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2972 |
End posion on genome | 3058 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcatcacatt |
tRNA gene sequence |
GCGGCCGTGGCGAAACTGGTAGACGCACAACGTTGAGGGCGTTGCGGGTTCATTCCCATG |
Downstream region at tRNA end position |
gatccaagat |
Secondary structure (Cloverleaf model) | >WENV170652506 Leu GAG t ACCA gatccaagat G - C C - G G - C G - C C - G C - G G - C T G T C C T C C A C A A G | | | | | A T A G C G G G A G G C G | | | T T G A C G C T A G A CGGGTTCATTCCCAT C - G A - T A - T C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |