Sequence ID | >WENV170652507 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3070 |
End posion on genome | 3146 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
atccaagatt |
tRNA gene sequence |
GCACCCGTAGCTCAACTGGAGAGAGCGCCGGACTACGAATCCGGAGGTTGCGCGTTCGAC |
Downstream region at tRNA end position |
ttctcctcgc |
Secondary structure (Cloverleaf model) | >WENV170652507 Arg ACG t GCCA ttctcctcgc G - C C - G A - T C - G C - G C - G G - C T C T C G T G C A C A A A | | + | | G T C T C G G C G C G C G | | | | T T G G A G C A G A G AGGTT C - G C - G G - C G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |