Sequence ID | >WENV170652508 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3178 |
End posion on genome | 3253 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttacgacatt |
tRNA gene sequence |
GCCAAGATAGCTCAGTCGGTAGAGCGGCAGCTTGAAGAGCTGCGCGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
actcgctgca |
Secondary structure (Cloverleaf model) | >WENV170652508 Phe GAA t GCCA actcgctgca G - C C - G C - G A - T A - T G - C A - T C T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A G GCGTC G - C C - G A - T G - C C - G T A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |