Sequence ID | >WENV170652509 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3318 |
End posion on genome | 3395 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggagcaaatt |
tRNA gene sequence |
GCGGGTGTAGCTCAGCCAGGCCAGAGCAACGGCTTGTCACGCCGTAGGTCGGGGGTTCGA |
Downstream region at tRNA end position |
tagcgcccac |
Secondary structure (Cloverleaf model) | >WENV170652509 Asp GTC t GCCA tagcgcccac G - C C - G G - C G - C G - C T - A G - C T G T T C C C C A C C G A A + | | | | G A C T C G G G G G G C G | | | | T T G G A G C C C A A AGGTC A - T C - G G - C G - C C - G T C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |