Sequence ID | >WENV170652512 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4522 |
End posion on genome | 4596 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttccggattt |
tRNA gene sequence |
TGAGGTGTAGTTCAGCGGTAGAACGCCACACTGTTAATGTGGATGTCGCTGGTTCGAGTC |
Downstream region at tRNA end position |
gattgccggc |
Secondary structure (Cloverleaf model) | >WENV170652512 Asn GTT t GCCA gattgccggc T - A G - C A - T G - C G - C T + G G - C T G T C G A C C A G A A | | | | | G C C T T G G C T G G C G | | | | T T G G A A C T A G ATGTC C - G C - G A - T C - G A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |