Sequence ID | >WENV170652513 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4601 |
End posion on genome | 4677 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cagccagatt |
tRNA gene sequence |
GCCGGCATAGCTCAGCGGTAGAGCGGTGGTTTCATAAGCCGCGTCAGTCGCAGGTTCAAT |
Downstream region at tRNA end position |
gatgtcgccg |
Secondary structure (Cloverleaf model) | >WENV170652513 Met CAT t ACCA gatgtcgccg G - C C - G C - G G - C G - C C - G A - T T T T C G T C C A G A A | | | | | A C C T C G G C A G G C G | | | | T T G G A G C T A G GTCAGTC G - C T + G G - C G - C T + G T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |