Sequence ID | >WENV170652514 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4849 |
End posion on genome | 4940 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caaccgactc |
tRNA gene sequence |
GGATGTGTGGGTGAGTGGTTGAAACCAGCACTTTGCTAAAGTGTCGCACCCCGAAAGGGG |
Downstream region at tRNA end position |
ggaatgggcg |
Secondary structure (Cloverleaf model) | >WENV170652514 Ser GCT c GCCA ggaatgggcg G - C G - C A - T T - A G - C T - A G - C T A T C G T C C A T G A G | | | | | G G G T G G G C A G G C G | | | T T T A A C C T G A A CGCACCCCGAAAGGGGTGTC G + T C - G A - T C - G T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |