Sequence ID | >WENV170652515 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4946 |
End posion on genome | 5021 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgccaggaat |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGGAGAGCGCCTCGCTTACACCGAGGATGTCGGCGGTTCAATC |
Downstream region at tRNA end position |
ttcctttcag |
Secondary structure (Cloverleaf model) | >WENV170652515 Val TAC t ACCA ttcctttcag G - C G - C G - C C - G G - C C - G T - A C T T C T G C C A C G A A | + | | | A T C T C G G G C G G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A C - G G - C C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |