Sequence ID | >WENV170652517 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 5491 |
End posion on genome | 5565 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctaggaaatt |
tRNA gene sequence |
GCGGGTATAGCTCAATGGCAGAGCCACAGCCTTCCAAGCTGAAGACGAGGGGTTCGATTC |
Downstream region at tRNA end position |
gccgaccgac |
Secondary structure (Cloverleaf model) | >WENV170652517 Gly TCC t TCCA gccgaccgac G - C C - G G - C G - C G - C T - A A - T T T T C C C C C A A A A | | | | G T C T C G A G G G G C G | | | | T T G G A G C C A C AGACG A A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |