Sequence ID | >WENV170652518 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6012 |
End posion on genome | 6087 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggcccaaatt |
tRNA gene sequence |
GGGGCGATAGCTCAGCTGGGAGAGCACCTGCCTTGCAAGCAGGATGTCACCGGTTCGATC |
Downstream region at tRNA end position |
tctacggtgc |
Secondary structure (Cloverleaf model) | >WENV170652518 Ala TGC t ACCA tctacggtgc G - C G - C G + T G - C C - G G - C A - T C T T T G G C C A C G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C G A A ATGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |