Sequence ID | >WENV170652520 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6454 |
End posion on genome | 6529 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gcaacgactt |
tRNA gene sequence |
GCCGGCCTGGTCCAGATGGGATGGACAGCGCCTTGGTACGGTGCAGACGCGGGTTCGAGG |
Downstream region at tRNA end position |
cgacgaacga |
Secondary structure (Cloverleaf model) | >WENV170652520 Thr GGT t TCCA cgacgaacga G - C C - G C - G G - C G - C C - G C - G G G T C G C C C A A G A G | | | | | G T C C T G G C G G G C G | | | | T T G G G A C G A T A AGAC G - C C - G G + T C - G C - G T C T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |