Sequence ID | >WENV170652521 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6544 |
End posion on genome | 6618 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gaacgatcag |
tRNA gene sequence |
GATCCGATGGCTGAGCGGCAAAGGCACCGGTCTGCAAAACCGGCCACGTCGGTTCGACTC |
Downstream region at tRNA end position |
cgacagcgat |
Secondary structure (Cloverleaf model) | >WENV170652521 Cys GCA g TCCA cgacagcgat G - C A - T T - A C - G C - G G - C A - T T C T C A G C C A C G A G | | | | | G G G T C G G T C G G C G + | | T T C A G G C A A A CCAC C - G C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |