Sequence ID | >WENV170652522 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 6681 |
End posion on genome | 6767 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cataagcctt |
tRNA gene sequence |
GCGCCCGTGGCGAAACTGGCAGACGCACCGTCTTCAGGAGGCGGCGCTCGCAAGAGCATG |
Downstream region at tRNA end position |
tcgattgccg |
Secondary structure (Cloverleaf model) | >WENV170652522 Leu CAG t ACCA tcgattgccg G - C C - G G - C C - G C - G C - G G - C C C T C G T C C A C A A G | | | | | A T A G C G G C A G G C G | | | T T G A C G C C A G A CGCTCGCAAGAGCAT C - G C - G G - C T + G C - G T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |