Sequence ID | >WENV170652525 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8293 |
End posion on genome | 8382 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tcaaaattgc |
tRNA gene sequence |
GGAGGGGTGCCGGAGCGGCTGAACGGGGCGGTCTCGAAAACCGCTGTACCCGCCAGGGTA |
Downstream region at tRNA end position |
tgcaagcgtc |
Secondary structure (Cloverleaf model) | >WENV170652525 Ser CGA c GCCA tgcaagcgtc G - C G - C A - T G - C G - C G - C G - C T A T C A C T C A C G A G | | | | | G G G G C C G T G A G C G | | | T T C A C G G T G A G TGTACCCGCCAGGGTACC G - C C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |