Sequence ID | >WENV170652526 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8416 |
End posion on genome | 8492 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gaaaccatct |
tRNA gene sequence |
CGGGGCATAGCTCAGCCAGGCAGAGCGCCACGTTCGGGACGTGGAGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
ttgccacttg |
Secondary structure (Cloverleaf model) | >WENV170652526 Pro CGG t ACCA ttgccacttg C - G G - C G - C G - C G - C C - G A - T G A T C C T C C A C G A A | | | | | G C C T C G G G A G G C A | | | | T T G G A G C G C A G AGGCC C - G C - G A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |