Sequence ID | >WENV170652527 |
Genome ID | JRYH01005205 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8663 |
End posion on genome | 8755 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgcccatgcc |
tRNA gene sequence |
GGATAGATGGCCGAGTGGCTGAAGGCGCCGAGCTGGAAACTCGGTAACGCTCGACGAGGG |
Downstream region at tRNA end position |
agtaccggta |
Secondary structure (Cloverleaf model) | >WENV170652527 Ser GGA c GCCA agtaccggta G - C G - C A - T T - A A - T G - C A - T T A T T C T C C A T G A G | | | | | G G G C C G A G A G G C G | | | T T C A G G C T G A G TAACGCTCGACGAGGGCGTTC C - G C - G G - C A - T G - C C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |